CN102552452A

CN102552452A - Pharmaceutical composition used for treating virus B hepatitis and its preparing method and application

Info

Publication number: CN102552452A
Application number: CN2012100307044A
Authority: CN
Inventors: 谢守德; 李希; 廖志航; 陈开国; 曹定知; 陈东辉; 张嵩; 冯建安; 周丽娟; 杨炀; 黄嫣
Original assignee: Sichuan Academy of Chinese Medicine Sciences SACMS
Current assignee: Sichuan Academy of Chinese Medicine Sciences SACMS
Priority date: 2011-02-15
Filing date: 2012-02-10
Publication date: 2012-07-11
Anticipated expiration: 2032-02-10
Also published as: CN102552452B

Abstract

The invention provides a pharmaceutical composition used for preventing and treating virus B hepatitis. The pharmaceutical composition is a preparation prepared from the following bulk drugs by weight: 1 to 20 parts of gentrin knotweed, 1 to 15 parts of bushy sophora, 1 to 24 parts of Penthorum chinense Pursh and 1 to 10 parts of coptis. The invention also provides a preparing method and application of the pharmaceutical composition. The pharmaceutical composition provided in the invention can increase the level of mRNA of OAS and PKR in a cell and improve the protein level of OAS and PKR, thereby having a good anti-HBV effect, can improve liver injury, having an obvious liver protecting effect, can increase secretory volume of bile, having a certain gallbladder benefiting effect, has a substantial effect on strengthening capability of mouse peritoneal macrophages in phagocytosing chicken red blood cells, enables the phagocytosis rate of the mouse peritoneal macrophages and phagocytosis indexes to be substantially increased compared to control groups, and has an obvious effect on improving low formation of mouse hemolysin antibodies caused by cyclophosphamide.

Description

A kind of pharmaceutical composition and method for preparing and purposes of treating hepatitis B

Technical field

The present invention relates to a kind of pharmaceutical composition of hepatitis B and Use and preparation method of this pharmaceutical composition of treating.

Background technology

Hepatitis B is one of common viral hepatitis; Mainly be divided into acute hepatitis B, chronic hepatitis B and heavy hepatitis B etc. clinically; Can propagate through modes such as blood, mother and baby, damaged skin and property contacts, also be common chronic infectious disease.According to The World Health Organization (WHO), chronic hepatitis B accounts in the global top ten disease cause of the death the 7th, and wherein 30% hepatitis B patient develops into liver cirrhosis and hepatocarcinoma the most at last, and only China is annual just has 300,000 people to die from the disease that hepatitis B virus infection causes.At present, adopt nucleoside analog and interferon that hepatitis B and hepatitis B virus carriers are treated more.Wherein, The normal nucleoside analog that uses has lamivudine, adefovirdipivoxil fat, Entecavir, Sebivo, tenofovir ester etc., and its overall security and toleration are good, but in clinical practice, rare, rare serious adverse reaction can take place; Like renal insufficiency, myositis, rhabdomyolysis, lactic acidosis etc.; In case and drug withdrawal, most of patient's hepatitis B virus DNA polymerase parameter bounce-back, higher before the ratio that the has treatment.

Under the situation of Western medicine to the treating hepatitis B poor effect, people begin to turn one's attention to Chinese medicine.At present, be that the effectively new drug of treatment hepatic disease is sought on the basis with the theory of Chinese medical science, become the new direction of current medical personnel's research.

Summary of the invention

Technical program of the present invention lies in providing a kind of pharmaceutical composition of effective treatment hepatitis B.Another technical scheme of the present invention has provided this preparation of drug combination method and purposes.

The invention provides a kind of pharmaceutical composition of preventing and treating hepatitis B, it is the preparation that is prepared from following materials of weight proportions medicine:

Rhizoma Polygoni Cuspidati 1-20 part, Radix Sophorae Tonkinensis 1-15 part, Penthorum chinense 1-24 part, Rhizoma Coptidis 1-10 part.

Further preferably, it is the preparation that is prepared from following materials of weight proportions medicine:

Rhizoma Polygoni Cuspidati 9-15 part, Radix Sophorae Tonkinensis 3-6 part, Penthorum chinense 9-24 part, Rhizoma Coptidis 2-5 part.

12 parts of Rhizoma Polygoni Cuspidati, 6 parts of Radix Sophorae Tonkinensiss, 12 parts of Penthorum chinense, 2 parts of Rhizoma Coptidis.

Pharmaceutical composition of the present invention is to be active component by raw material medicated powder of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis, Penthorum chinense, Rhizoma Coptidis or extractive with organic solvent, adds acceptable accessories or complementary composition and is prepared into preparation pharmaceutically commonly used.

Wherein, described preparation is decoction, powder, pill, granule, tablet, capsule, oral liquid or drop pill.

Wherein, in the described capsule, every contains Rhizoma Polygoni Cuspidati with emodin C ₁₅H ₁₀O ₅Meter must not be less than 4.50mg.

The present invention also provides a kind of method for preparing described pharmaceutical composition, and it comprises the steps:

(1) get the crude drug of recipe quantity, pulverize, medicated powder is subsequent use; Or

(2) get the crude drug of recipe quantity, add water or organic solvent extraction, the active component that extracts gained is subsequent use;

(3) get the medicated powder of step (1) gained or the active component of step (2) gained, add adjuvant or complementary composition pharmaceutically commonly used, be prepared into preparation pharmaceutically commonly used.

Wherein, described preparation is a capsule, and its preparation method is:

A, get Rhizoma Polygoni Cuspidati 1-100 part and Radix Sophorae Tonkinensis 1-100 part, add the 60%-80% ethanol of 6-8 times of medical material weight, reflux, extract, 1-3 time, each 60-120min merges alcohol extract, filters, and decompression recycling ethanol concentrates, and concentrated solution is subsequent use;

B, get Penthorum chinense 1-100 part, add 6-10 times of medical material weight water, soak 30-45min, decocts 1-3 time, each 60-90min, merge extractive liquid, behind the concentrating under reduced pressure, adds ethanol and reaches 60% to containing the alcohol amount, precipitate with ethanol, filtration, decompression recycling ethanol, concentrated, concentrated solution is subsequent use;

C, get Rhizoma Coptidis 1-100 part, add 6-10 times of medical material weight water, soak 30-60min, decocts 1-3 time, each 40-80min, the merging Rhizoma Coptidis extract, after the remove impurity, concentrated, concentrated solution is subsequent use;

D, above-mentioned each concentrated solution of merging, encapsulated after the conventional method of granulating of employing is granulated, promptly get.

Further preferably, the method for preparing of described capsule is:

A, get 6 parts of 12 parts of Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensiss, add 60% ethanol of 8 times of medical material weight, reflux, extract, 3 times; Each 120min merges alcohol extract, filters; 80 ℃ of temperature, vacuum-0.08～-0.1Mpa recover ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) is subsequent use;

B, get 12 parts of Penthorum chinense, add 10 times of medical material weight water, soak 45min, decoct 3 times; Each 90min merges the Penthorum chinense extracting solution, 80 ℃ of temperature, vacuum-0.08～-to be concentrated into relative density under the 0.1Mpa be 1.15-1.18; Add ethanol and reach 60%, stir, leave standstill 24h to containing the alcohol amount; Filter, 80 ℃ of temperature, vacuum-0.08～-0.1Mpa recover ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) is subsequent use;

C, get 2 parts of Rhizoma Coptidis, add 8 times of medical material weight water, soak 45min; Decoct 3 times, each 60 minutes, merge Rhizoma Coptidis extract; With the rotating speed is that 6000r/min is centrifugal, 80 ℃ of temperature, vacuum-0.08～-clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) under the 0.1Mpa is subsequent use;

D, above-mentioned each clear paste of merging are spray drying under 90～100 ℃ of conditions in 180～200 ℃ of EATs, leaving air temp, collect spray powder; Be lower than 60.5% in relative humidity, dry granulation under the condition that temperature is 18～22 ℃ (principal pressure 4.5～5.5Mpa, lateral pressure 0.25Mpa); Sieve; Collect the granule of 40～60 mesh sieves, encapsulated, promptly get.

The present invention also provides the purposes of this pharmaceutical composition in the medicine of preparation prevention or treatment hepatitis B.

The present invention provides also that this pharmaceutical composition protects the liver in preparation, the purposes in the medicine of enhance immunity or function of gallbladder promoting.

Rhizoma Polygoni Cuspidati in the drug regimen raw material of the present invention is dry rhizome and the root of Polygonaceae Polygonaceae plant polygonum cuspidatum Polygonum cuspidatum Sieb.et Zucc..Little hardship is slightly cold, and returns liver, gallbladder, lung meridian.Function eliminating damp-heat, promoting the function of the gallbladder to alleviate jaundice, blood circulation promoting and blood stasis dispelling; The detoxifcation pain relieving; Modern study thinks that its effective ingredient is mainly anthraquinone class and diphenylethylene compounds, has antibiotic, antioxidation, prevents and treats heart disease, multiple effect such as anticancer, blood fat reducing, cholesterol reducing.Radix Sophorae Tonkinensis is the dry root and rhizome of dicotyledon medicine leguminous plant Sophora tonkinensis Gagnep. Sophorae Tonkinensis Gagnep., nature and flavor: hardship, and cold.Heat-clearing and toxic substances removing, relieving sore throat and diminishing swelling, modern study think that Radix Sophorae Tonkinensis contains abundant flavone, alkaloid and Saponin composition, and contains phenolic constituent and lignan component, have physiologically actives such as arrhythmia, anti-hepatitis, antiinflammatory.Penthorum chinense is the herb of Crassulaceae penthorum plant Penthorum chinense Penthorum chinense Pursh, sweet in the mouth; Slightly warm in nature, function cures mainly: diuretic dehumidifying, stasis-dispelling and pain-killing; Be used for jaundice, edema, traumatic injury is controlled in external; Modern study thinks that its main effective ingredient is Quercetin and Galla Turcica (Galla Helepensis) class.Rhizoma Coptidis is the dry rhizome of ranunculaceae plant Rhizoma Coptidis Coptis chinensis Franch. Coptis deltoidea C.Y.Cheng et Hsiao Coptis deltoidea C.Y.Chenget Hsiao or Coptis Teeta Wall Coptis teeta Wall., and bitter in the mouth is cold in nature, heat clearing and damp drying; Eliminating fire and detoxication is used for damp and hot feeling of fullness, vomiting acid regurgitation, dysentery, jaundice; Unconsciousness due to high fever, hyperactivity of heart-fire, dysphoria and insomnia, heat in blood is told nosebleed, conjunctival congestion; Carbuncle furuncle, external treatment eczema are quenched one's thirst in toothache; Eczema, auditory meatus is suppurated, and mainly contains Protoberberine Alkoloids, has the effect of broad ectrum antibiotic.

Be monarch with the blood stasis dispelling of Rhizoma Polygoni Cuspidati heat-clearing and toxic substances removing dampness removing in the raw material prescription of the present invention, be aided with Radix Sophorae Tonkinensis heat-clearing and toxic substances removing, Penthorum chinense dampness removing jaundice eliminating, dissolving blood stasis and detoxication, assistant is with Rhizoma Coptidis heat clearing and damp drying, eliminating fire and detoxication.Full side's eliminating damp-heat, the detoxifcation pain relieving, dissipating blood stasis protects the liver, and can increase the mRNA level of OAS, PKR in the cell, strengthens OAS, PKR protein level, has anti-preferably HBV effect.Pharmaceutical composition of the present invention can also improve hepatic injury, has tangible hepatoprotective effect; Improve choleresis, have certain choleretic effect; Turnover of Mouse Peritoneal Macrophages is engulfed the chicken red blood cell ability be significantly increased, Turnover of Mouse Peritoneal Macrophages phagocytic rate, phagocytic index are significantly increased than matched group; Cyclophosphamide is caused the mice hemolytic antibody generate the effect that lowly is significantly improved.

Description of drawings

Fig. 1: pharmaceutical composition of the present invention is to HBeAg (OD) influence (wherein, DMSO represents 0.1% dimethyl sulfoxide, and LAM represents lamivudine, and HH represents medicine capsule of the present invention)

Fig. 2: pharmaceutical composition of the present invention influences HBsAg (OD)

Fig. 3: the outer HBVDNA influence of pharmaceutical composition pair cell of the present invention

Fig. 4: HBVDNA influence in the pharmaceutical composition pair cell of the present invention

Fig. 5: OAS, PKRmRNA influence in the pharmaceutical composition pair cell of the present invention

Fig. 6: OAS, the influence of PKR albumen in the pharmaceutical composition pair cell of the present invention

Fig. 7: OAS, PKR Western blot figure

The specific embodiment

Embodiment 1 preparation of drug combination of the present invention

A, get Rhizoma Polygoni Cuspidati 1333.3g and Radix Sophorae Tonkinensis 666.7g; 60% ethanol that adds 8 times of medical material weight, reflux, extract, 3 times, each 120min; Merge alcohol extract; Filter, 80 ℃ of temperature, vacuum-0.08～-0.1Mpa recover ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) is subsequent use;

B, get Penthorum chinense 1333.3g, add 10 times of medical material weight water, soak 45min, decoct 3 times; Each 90min merges the Penthorum chinense extracting solution, 80 ℃ of temperature, vacuum-0.08～-to be concentrated into relative density under the 0.1Mpa be 1.15-1.18; Add ethanol and reach 60%, stir, leave standstill 24h to containing the alcohol amount; Filter, 80 ℃ of temperature, vacuum-0.08～-0.1Mpa recover ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) is subsequent use;

C, get Rhizoma Coptidis 222.2g, add 8 times of medical material weight water, soak 45min; Decoct 3 times, each 60 minutes, merge Rhizoma Coptidis extract; With the rotating speed is that 6000r/min is centrifugal, 80 ℃ of temperature, vacuum-0.08～-clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) under the 0.1Mpa is subsequent use;

D, above-mentioned each clear paste of merging are spray drying under 90～100 ℃ of conditions in 180～200 ℃ of EATs, leaving air temp, collect spray powder; Be lower than 60.5% in relative humidity, dry granulation under the condition that temperature is 18～22 ℃ (principal pressure 4.5～5.5Mpa, lateral pressure 0.25Mpa); Sieve; Collect the granule of 40～60 mesh sieves, encapsulated, promptly get 1000 medicament composition capsule agent of the present invention.

Embodiment 2 preparation of drug combination of the present invention

Get the clear paste of A among the embodiment 1, B, C step gained, after the merging, be concentrated into relative density 1.1-1.30 (60 ℃), add an amount of dextrin or starch and be prepared into granule;

With the granule for preparing encapsulated after, promptly get capsule.

Embodiment 3 preparation of drug combination of the present invention

Get Rhizoma Polygoni Cuspidati 12g, Radix Sophorae Tonkinensis 6g, Penthorum chinense 12g, Rhizoma Coptidis 2g, decocte with water 3 times, each 30 minutes, merge decocting liquid, filter, be concentrated into relative density 1.1-1.30 (60 ℃), add an amount of soluble starch and be prepared into granule;

With the granule for preparing, add an amount of magnesium stearate again, tabletting promptly gets tablet.

Embodiment 4 preparation of drug combination of the present invention

Get Rhizoma Polygoni Cuspidati 1g, Radix Sophorae Tonkinensis 1g, Penthorum chinense 1g, Rhizoma Coptidis 100g, decocte with water 1 time; 60 minutes, decocting liquid filtered, and concentrated, add an amount of ethanol or chitosan remove impurity after, the centrifugal deposition of removing; Supernatant adds an amount of antiseptic and correctives after suitably concentrating, and fill prepares oral liquid of the present invention.

Embodiment 5 preparation of drug combination of the present invention

Get Rhizoma Polygoni Cuspidati 20g, Radix Sophorae Tonkinensis 1g, Penthorum chinense 1g, Rhizoma Coptidis 1g after the pulverizing, adds suitable adjuvant, general pill agent.

Embodiment 6 preparation of drug combination of the present invention

Get Rhizoma Polygoni Cuspidati 1g, Radix Sophorae Tonkinensis 15g, Penthorum chinense 20g, Rhizoma Coptidis 10g, after the decocte with water, remove impurity promptly gets pharmaceutical composition decoction of the present invention.

Embodiment 1-5 is to preparation of drug combination method of the present invention; Should not be construed as is the restriction to protection domain of the present invention; All based on above-mentioned technological thought, the modification, replacement, the change that utilize ordinary skill knowledge and customary means to make all belong to scope of the present invention.

The quality standard of embodiment 7 embodiment 1 capsule

1, assay

Rhizoma Polygoni Cuspidati is we's a monarch drug, and the master contains the dissociated anthraquinone derivant: emodin, chrysophanol, physcione are antimicrobial component.Still contain flavone compounds such as resvertrol, polygonin, tannin and Quercetin, modern pharmacological research shows that anthraquinones such as emodin have antivirus action, can suppress the hepatitis B antigen positive.So select the index components of emodin as these article of control.The emodin content assay method, mostly that has reported is HPLC, the relevant document of this canonical reference has been set up emodin content in these article of high effective liquid chromatography for measuring.Detection to the emodin peak is mainly uv detection method, and its wavelength is 254nm, selects Agilent Eclipse XDB-C in the test ₁₈Post (5 μ m; 150mm * 4.6mm) carry out methodology to examine or check; With methanol-0.1% phosphoric acid solution (80: 20) and methanol-0.1% phosphoric acid solution mobile phases such as (85: 15) separating to sample; When the result was methanol-0.1% phosphoric acid solution (80: 20) with the mobile phase ratio, the emodin peak was good with separating of adjacent peak, and the theoretical cam curve at emodin peak is higher.

(1) instrument and reagent

Instrument: Agilent 1100 type high performance liquid chromatographs, U.S. Agilent company; The Agilent chromatographic work station; The VWD UV-detector, U.S. Agilent company; Sartorius BP211D electronic balance (0.01mg), Germany; The ultrasonic extraction device, 726 of middle ship No. 7 Institutes.

Reagent: high performance liquid chromatogram uses methanol to be chromatographically pure (U.S. Fisher company product), and water is ultra-pure water (self-control), and other reagent is analytical pure.

Reference substance: the emodin reference substance provides (lot number 110756-200110 supplies assay to use) by Nat'l Pharmaceutical & Biological Products Control Institute

Sample: embodiment 1 makes (lot number: 060801,060802,060803).

(2) chromatographic condition

Chromatographic column: Agilent Eclipse XDB-C18 (5 μ m, 150mm * 4.6mm); Guard column: Agilent ZORBAX XDB-C18 (5 μ m, 4mm * 4mm); Mobile phase: methanol-0.1% phosphoric acid solution (80: 20); Flow velocity: 1.0ml/min; Column temperature: 30 ℃; Detect wavelength 254nm.

This chromatographic condition is noiseless to the mensuration feminine gender of emodin; Its retention time is about 6.5 minutes; The separating of emodin peak and adjacent peak good (Rs＞1.5), press the calculating of emodin peak, number of theoretical plate is more than 9000; For making quantitative analysis more accurate, so the regulation number of theoretical plate is not less than 6000 in the system suitability test.

(3) examination of linear relationship

Precision takes by weighing emodin reference substance 5.46mg, put in the 50ml measuring bottle, with dissolve with methanol and be settled to scale, every 1ml contains the reference substance solution of emodin 0.1092mg.Above-mentioned solution 2,4,6,8, the 10 μ l of accurate respectively absorption inject hplc determination, and the result sees table 1.

The result is measured in the examination of table 1 emodin reference substance linear relationship

With sample size X (μ g) be abscissa, peak area integrated value Y is vertical coordinate mapping, carries out linear regression, regression equation be: Y=4076.08X-125.5481, r=0.99998.

Can know that by above result emodin is good in 0.2184 μ g～1.092 μ g scope internal linear relation.

(4) preparation of need testing solution

" the emodin content assay method is that sample adds chloroform and sulphuric acid extraction in a Rhizoma Polygoni Cuspidati medical material of Chinese pharmacopoeia version in 2005 assay; Therefore the extraction solvent to these article adopts chloroform; And adding sulfuric acid solution hydrolysis when extracting; Method for distilling adopts heat reflow method, and the sulphuric acid hydrolysis time is examined or check.

These article of getting content, porphyrize is got about 0.5g, and accurate title is fixed, and accurate chloroform 50ml and the 2.5mol/L sulfuric acid solution 20ml of adding claims to decide weight, puts difference reflux 1,1.5,2h in 80 ℃ of water-baths, and be cold really to room temperature.Claim again to decide weight, add chloroform and supply the weight that subtracts mistake, shake up.Obtain chloroform liquid, precision is measured 2ml, and evaporate to dryness, residue add methanol makes dissolving, is transferred in the 10ml measuring bottle, adds methanol and is diluted to scale, and centrifugal, supernatant is as need testing solution.According to content in the content assaying method working sample, the result sees table 2.

Table 2 hydrolysis time examination result

Above result shows that hydrolysis 1.5h is above to be influenced not quite the emodin content result, and for guaranteeing extraction effect, the selection hydrolysis time is 2h.

In sum, the method for preparing of need testing solution is: get these article content, porphyrize; Get about 0.5g, the accurate title, decide, accurate chloroform 50ml and the 2.5mol/L sulfuric acid solution 20ml of adding; Claim to decide weight, put difference reflux 2h in 80 ℃ of water-baths, cold really to room temperature.Claim again to decide weight, add chloroform and supply the weight that subtracts mistake, shake up.Obtain chloroform liquid, precision is measured 2ml, and evaporate to dryness, residue add methanol makes dissolving, is transferred in the 10ml measuring bottle, adds methanol and is diluted to scale, and centrifugal, supernatant is as need testing solution.

(5) precision test

Accurate suction line sexual relationship examination item is reference substance solution (concentration is 0.1092mg/ml) 5 μ l down, continuous sample introduction 5 times, and RSD=0.235 shows that this mensuration system precision is good.

(6) repeatability test

To 5 parts of same lot sample article (lot number 060801) samplings, measure by the content assaying method of drafting respectively, RSD=2.521% shows that repeatability is good.

(7) stability test

The accurate reference substance solution 5 μ l that draw injected high performance liquid chromatograph respectively at 0 hour, 2 hours, 4 hours, 8 hours, 24 hours, measured the peak area of emodin, and RSD=0.737% shows that reference substance solution is good at 24 hours internal stabilities.

(8) recovery test

Get the about 0.25g of sample (lot number 060301) of known content (11.16mg/g); It is an amount of to add the emodin reference substance respectively, measures by the method for preparing and the chromatographic condition of aforementioned finished product need testing solution, and average recovery rate is 98.59%; RSD=1.977% shows that this law response rate is good.

(9) mensuration of sample

Get the sample of different lot numbers, measure by the aforementioned content assaying method of drafting, the result sees table 3.

The mensuration result of emodin (n=2) in table 3 sample

According to above mensuration result, consider emodin content difference in source and the medical material of medical material, and factors such as preparation production, storage, so tentative every of this standard contains Rhizoma Polygoni Cuspidati with emodin (C ₁₅H ₁₀O ₅) meter, must not be less than 4.50mg.

The screening of embodiment 8 preparation of pharmaceutical compositions technologies of the present invention

1, Rhizoma Polygoni Cuspidati, the research of Radix Sophorae Tonkinensis alcohol extraction process

1.1 inhale the examination of pure rate

In the prescription ratio, take by weighing Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis 72g, add 10 times of amount 60% soak with ethanol to passing through the heart, filter, record and inhale pure rate, the result sees table 4.

Table 4 is inhaled pure rate and is measured the result

Above result shows that the suction alcohol rate of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis is 163.12%, answers the about 1.6 times of amount alcohol of extra adding to supply the suction alcohol amount of medical material during therefore first the extraction.

1.2 experimental technique

The factor that influences Chinese crude drug alcohol extraction effect mainly contains: pulverizing medicinal materials granularity, extraction temperature, soak time, concentration of alcohol, alcohol adding amount, return time, backflow number of times etc.Therefore, this research is respectively established three levels to concentration of alcohol, alcohol adding amount, return time, four factors of backflow number of times, according to L ₉(3 ⁴) orthogonal table arrangement test, factor level is seen table 5.Because monarch drug in Rhizoma Polygoni Cuspidati be the side, emodin is its main component, so be to examine or check index with the emodin content, because of paste-forming rate is a material base of bringing into play curative effect, so uses the yield of dried cream to estimate as index equally.

Table 5 Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis factor level table

Take by weighing Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis in the prescription ratio, extract, filter by the orthogonal test condition, merging filtrate, subsequent use.

The assay method of each evaluation index

1. emodin content is measured

Emodin content is measured: adopt HPLC.

Chromatographic condition: Agilent 1100 type high performance liquid chromatographs, the VWD UV-detector, chromatographic column Agilent Eclipse XDB-C18 post (4.6 * 150mm, 5um); Mobile phase is methanol: 0.1% phosphoric acid (85: 15); Flow velocity: 1ml/min; 30 ℃ of column temperatures; Ultraviolet detection wavelength: 254nm.

The preparation of reference substance solution: get emodin reference substance 5.42mg (lot number 0756-9908), in the 50ml volumetric flask, add dissolve with methanol and add methanol and be diluted to scale; Shake up, get again in 1ml to the 10ml measuring bottle, add methanol and be diluted to scale; Shake up, get the emodin reference substance solution of 0.01084mg/ml.

The preparation of need testing solution: get the extracting solution under the orthogonal test item, measure cumulative volume, a certain amount of medicinal liquid of therefrom accurate absorption adds methanol and is diluted to scale in the 100ml measuring bottle, shakes up; Filter, precision is measured subsequent filtrate 10ml, puts in the 100ml round-bottomed flask, volatilizes; Add 2.5mol/L sulfuric acid solution 20ml, reflux 1 hour, cold slightly, add the about 30ml of chloroform; Continue to reflux 2 hours, cooling is in the dislocation separatory funnel, with a small amount of chloroform washing container; Washing liquid is incorporated in the separatory funnel, obtains in the chloroform stratification 50ml measuring bottle, and acid solution is with chloroform extraction 2 times, about at every turn 8ml; Chloroform liquid is incorporated in the 50ml measuring bottle, adds chloroform to scale, shakes up, and promptly gets.

The preparation of negative sample solution: measure and have noiselessly for investigating emodin content, need the preparation negative sample.Get the medical material that lacks Rhizoma Polygoni Cuspidati, extract by orthogonal test, precision is measured extracting liquid volume, processes negative sample solution by method under the preparation item of need testing solution with method.

The drafting of standard curve: according to HPLC " appendix VID test of Chinese pharmacopoeia version in 2005; Accurate respectively emodin reference substance solution 2,4,6,8,10, the 20 μ l that draw inject high performance liquid chromatograph; Measuring peak area according to above-mentioned chromatographic condition is vertical coordinate with peak area integrated value (Y); The content of emodin reference substance (X) (μ g) is abscissa, gets regression equation: Y=1812.01X-5.78131, r=0.99999

Algoscopy: accurate respectively reference substance solution 10,20 μ l of absorption and need testing solution 10 μ l inject high performance liquid chromatograph, measure, and calculate emodin content with two points external standard method.

In amount (the mg)/orthogonal test of emodin content=record emodin with the amount (mg) * 100% of medical material

2. the yield of dried cream

It is a certain amount of that precision is measured under the orthogonal test item extracting solution, puts in the evaporating dish that is dried to constant weight, behind evaporate to dryness in the water-bath, is dried to constant weight in 105 ℃, moves in the exsiccator, cooled off 30 minutes, accurately rapidly claims decide weight, calculating yield of extract.

Dried cream yield=survey gets dry extract heavily, and (g)/orthogonal test is the amount (g) * 100% with medical material

Orthogonal experiments and analysis in table 6,7,8.

Table 6 orthogonal experiments

The variance analysis of table 7 paste-forming rate

The variance analysis of table 8 emodin content

Can be known by intuitive analysis, be that the factor that index influences extraction effect is in proper order with the paste-forming rate: D＞A＞C＞B, The results of analysis of variance shows: the D factor has the influence of utmost point significance to experimental result, with A ₁B ₃C ₃D ₃Combination is best.Be that the factor that index influences extraction effect is in proper order with the emodin content: D＞B＞C＞A, The results of analysis of variance shows: the D factor has the significance influence to experimental result, with A ₃B ₃C ₃D ₃Combination is best, because the A factor is little to the result of the test influence, therefore comprehensive above result is with A ₁B ₃C ₃D ₃Combination is best, and promptly Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensis medical material add 8 times of amount 60% ethanol, reflux, extract, 3 times, each 120 minutes.

For proving conclusively the good and bad and stable of this technology, according to the optimum condition that is screened, to A ₁B ₃C ₃D ₃Process certification three times, the result sees table 9.

Table 9 demonstration test result

Above result shows that the extraction process of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis is rationally feasible.

2, Rhizoma Coptidis extraction process by water research

2.1 the examination of water absorption rate

Take by weighing Rhizoma Coptidis 50g, add 10 times of water gagings and be dipped to the heart, filter, record water absorption rate, the result sees table 10.

Table 10 water absorption rate is measured the result

Above result shows that the water absorption rate of Rhizoma Coptidis is 188%, answers the about 1.9 times of water gagings of extra adding to supply the water absorption of medical material during therefore first the extraction.

2.2 experimental technique

The factor that influences Chinese crude drug water extraction effect mainly contains: pulverizing medicinal materials granularity, extraction temperature, soak time, amount of water, decocting time, decoction number of times etc.This research is mainly respectively established three levels to soak time, amount of water, decocting time, four factors of decoction number of times, according to L ₉(3 ⁴) orthogonal table arrangement test, factor level is seen table 11.Because main effective ingredient is a berberine hydrochloride in the Rhizoma Coptidis,,, therefore, use the yield of dried cream to estimate equally as index because of paste-forming rate is a material base of bringing into play curative effect so serve as the examination index with the content of berberine hydrochloride.

Table 11 Rhizoma Coptidis factor level table

Take by weighing Rhizoma Coptidis medical material 100g, extract, filter by the orthogonal test condition, merging filtrate, subsequent use.

The assay method of each evaluation index

1. the assay of berberine hydrochloride

The assay of berberine hydrochloride: adopt HPLC.

Chromatographic condition: Agilent 1100 type high performance liquid chromatographs, the VWD UV-detector, chromatographic column Agilent Eclipse XDB-C18 post (4.6 * 150mm, 5um); Mobile phase is methanol-0.033mol/L potassium dihydrogen phosphate (30: 70); Flow velocity: 1ml/min; 25 ℃ of column temperatures; Ultraviolet detection wavelength: 265nm.

The preparation of reference substance solution: get berberine hydrochloride reference substance 5.25mg (lot number 110713-200208), in the 50ml volumetric flask, add dissolve with methanol and add methanol and be diluted to scale, shake up, the emodin reference substance solution of 0.105mg.

The preparation of need testing solution: get the extracting solution under the orthogonal test item, measure cumulative volume, a certain amount of medicinal liquid of therefrom accurate absorption adds methanol and is diluted to scale in the 50ml measuring bottle, shakes up, and filters, and promptly gets.

The drafting of standard curve: according to HPLC " appendix VID test of Chinese pharmacopoeia version in 2005; Accurate respectively berberine hydrochloride reference substance solution 2,4,6,8, the 10 μ l that draw inject high performance liquid chromatograph; Measuring peak area according to above-mentioned chromatographic condition, is vertical coordinate with peak area integrated value (Y), and the content of berberine hydrochloride reference substance (X) (μ g) is abscissa; Regression equation is: Y=4638.95X-427.72535, r=0.99957

Algoscopy: accurate respectively reference substance solution 5,10 μ l of absorption and need testing solution 10 μ l inject high performance liquid chromatograph, measure, and calculate the content of berberine hydrochloride with two points external standard method.

In amount (the mg)/orthogonal test of the content of berberine hydrochloride=record berberine hydrochloride with amount (mg) * 100% of medical material

2. the yield of dried cream

Orthogonal experiments and analysis in table 12,13,14.

Table 12 orthogonal experiments

The variance analysis of table 13 paste-forming rate

The variance analysis of table 14 content of berberine hydrochloride

Can be known by intuitive analysis, be that the factor that index influences extraction effect is in proper order with the paste-forming rate: D＞C＞B＞A, The results of analysis of variance shows: the D factor has the influence of utmost point significance to experimental result, with A ₂B ₃C ₃D ₃Combination is best.Be that the factor that index influences extraction effect is in proper order with the content of berberine hydrochloride: D＞A＞B＞C, The results of analysis of variance shows: the D factor has the influence of utmost point significance to experimental result, and the A factor has appreciable impact to experimental result, with A ₂B ₂C ₂D ₃Combination is best, owing to B, C factor influence not quite experimental result, and therefore comprehensive above result, selection A ₂B ₂C ₂D ₃Technology, promptly the Rhizoma Coptidis medical material adds 8 times of water gagings, soaks 45min, decocts each 60 minutes 3 times.

For proving conclusively the good and bad and stable of this technology, according to the optimum condition that is screened, to A ₂B ₂C ₂D ₃Process certification three times, the result sees table 15.

Table 15 Rhizoma Coptidis extraction process demonstration test

Above result shows: the water extraction process of Rhizoma Coptidis is stable, rationally feasible.

3, Penthorum chinense is put forward technical study

3.1 the examination of water absorption rate

Take by weighing Penthorum chinense 50g, add 10 times of water gagings and be dipped to the heart, filter, record water absorption rate, the result sees table 16.

Table 16 water absorption rate is measured the result

Above result shows that the water absorption rate of Penthorum chinense is 149.33%, answers the about 1.5 times of water gagings of extra adding to supply the water absorption of medical material during therefore first the extraction.

3.2 experimental technique

The factor that influences Chinese crude drug water extraction effect mainly contains: pulverizing medicinal materials granularity, extraction temperature, soak time, amount of water, decocting time, decoction number of times etc.This research is mainly respectively established three levels to soak time, amount of water, decocting time, four factors of decoction number of times, according to L ₉(3 ⁴) orthogonal table arrangement test, factor level is seen table 17.Because main effective ingredient is a small amount of alkaloid and flavone in the Penthorum chinense; Therefore I with the ethanol-soluble extractives of extracting solution as the examination index of estimating extraction effect; Because of paste-forming rate is the material base of performance curative effect, also use the yield of dried cream to estimate simultaneously as index.Adopt the mode of comprehensive grading to carry out overall merit to ethanol-soluble extractives and dried cream yield, because ethanol-soluble extractives and dried cream yield all have big meaning in Penthorum chinense extracts, so ethanol-soluble extractives and dried cream yield respectively account for 50% of comprehensive grading.

Table 17 Penthorum chinense extraction factor water-glass

Take by weighing Penthorum chinense medical material 100g, extract, filter by the orthogonal test condition, merging filtrate, subsequent use.

The assay method of each evaluation index

1. ethanol-soluble extractives is measured

Get the extracting solution under the orthogonal test item, measure cumulative volume, the therefrom accurate extracting solution that is equivalent to the 10g medical material approximately of drawing, water-bath is concentrated near doing in evaporating dish, adds an amount of kieselguhr and mixes thoroughly; Be transferred in the 250ml conical flask, the accurate ethanol 100ml that adds claims to decide weight, supersound process 30 minutes; Taking-up is put cold, claims to decide weight, adds ethanol and supplies the weight that subtracts mistake, shakes up; Filter, precision is measured subsequent filtrate 50ml in the evaporating dish of dry constant weight, and water-bath is waved most ethanol and is concentrated into driedly, is dried to constant weight in 105 ℃; Move in the exsiccator, cooled off 30 minutes, weight decided in accurate rapidly title, calculates ethanol-soluble extractives content.

2. the yield of dried cream

Orthogonal experiments and analysis in table 18,19.

Table 18 orthogonal experiments

Annotate: comprehensive grading=paste-forming rate * 50/18.62+ ethanol-soluble extractives * 50/8.47

Table 19 variance analysis

Can be known that by intuitive analysis the factor that influences extraction effect is in proper order: D＞C＞A＞B, The results of analysis of variance shows: the D factor has the influence of utmost point significance to experimental result, and the C factor has appreciable impact to the result, with A ₂B ₃C ₃D ₃Combination is best, and promptly the Penthorum chinense medical material adds 10 times of water gagings, soaks 45min, decocts each 90 minutes 3 times.

For proving conclusively the good and bad and stable of this technology, according to the optimum condition that is screened, to A ₂B ₃C ₃D ₃Process certification three times, the result sees table 20.

Table 20 demonstration test

Above demonstration test shows: the extraction process of Penthorum chinense is stable, rationally feasible.

4, impurity removal process

4.1 the remove impurity of alcohol extract

Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensis alcohol extract impurity are less, therefore directly select to filter to remove the solid impurity in the medicinal liquid.

4.2 the remove impurity of Rhizoma Coptidis aqueous extract

In the Rhizoma Coptidis decocting liquid because alkaloid such as berberine is soluble in hot water; Therefore carry out remove impurity to Rhizoma Coptidis aqueous extract employing insulation is centrifugal with method, the high speed centrifugation remove impurity is a kind of physical separation method, and separation degree is directly related with centrifuge speed; Rotating speed is high more, and to remove impurity many more; For guaranteeing curative effect, the control quality of the pharmaceutical preparations is investigated centrifugal rotational speed.

Experimental technique: get a certain amount of Rhizoma Coptidis medical material; Complying with the process conditions of being screened extracts; Filter while hot, get several parts of certain volume filtratings, centrifugal with 4000,6000,8000,12000 rev/mins rotating speed respectively; Get each centrifugal liquid again and measure content of berberine hydrochloride and dried cream yield respectively, the result sees table 21.

Table 21 different rotating speeds impurity-eliminating effect relatively

Above result shows: when rotating speed 6000 changes above, and paste-forming rate several no changes that descend, also several no changes of content of berberine hydrochloride, therefore selecting rotating speed is 6000r/min.

4.3 the remove impurity of Penthorum chinense aqueous extract

List of references, therefore mostly the remove impurity of Penthorum chinense is alcohol deposition method, adopts alcohol deposition method that it is carried out remove impurity, and during to precipitate with ethanol when relative density and precipitate with ethanol determining alcohol examine or check.

4.3.1 the examination of precipitate with ethanol relative density

It is a certain amount of to get Penthorum chinense, extracts by the preferred extraction process of orthogonal test, gets certain volume number part; Being concentrated into relative density respectively is 1.05-1.1,1.1-1.15,1.15-1.18, adds ethanol and reaches 60% to containing the alcohol amount, stirs; Leave standstill 24h; Filter, measure the ethanol-soluble extractives and the dried cream yield of filtrating, the result sees table 22.

The examination of table 22 precipitate with ethanol relative density

Above result shows: relative density to precipitate with ethanol after the influence of ethanol-soluble extractives and dried cream yield little, but relative density is big more few more with the alcohol amount, from practicing thrift the cost angle, relative density is 1.15-1.18 when selecting precipitate with ethanol.

4.3.2 the examination of determining alcohol during precipitate with ethanol

Get a certain amount of Penthorum chinense, extract by the preferred technology of orthogonal test, being concentrated into relative density is 1.15-1.18; Add ethanol and reach 50%, 60%, 70% respectively, stir, leave standstill 24h to containing the alcohol amount; Filter, measure the ethanol-soluble extractives and the dried cream yield of filtrating, the result sees table 23.

Table 23 precipitate with ethanol determining alcohol examination result

Above result shows: determining alcohol is not too big to result's influence during precipitate with ethanol, but that determining alcohol reaches 60% o'clock ethanol-soluble extractives is higher and paste-forming rate is moderate, and determining alcohol is 60% when therefore selecting precipitate with ethanol.

4.5 concentration technology research

4.5.1 alcohol extract concentration technology research

After filtering, Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis alcohol extract need to reclaim ethanol; Reconcentration is to the clear paste of certain relative density; We adopt decompression recycling ethanol method (80 ℃ of temperature, vacuum-0.08～-0.1Mpa) reclaim ethanol, and then vacuum-0.08～-clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) under the condition of 0.1Mpa is subsequent use.And emodin content before and after concentrating examined or check, the result is following:

Changes of contents behind table 24 alcohol extract recovery ethanol and the concentrating under reduced pressure

The result shows, adopts above condition to carry out concentrating under reduced pressure, and loss of effective components is little.

4.5.2 the concentration technology of Rhizoma Coptidis aqueous extract

Concentrating under reduced pressure is adopted in the centrifugal back of Rhizoma Coptidis aqueous extract, 80 ℃ of thickening temperatures of control, vacuum-0.08～-0.1Mpa, the clear paste that medicinal liquid is concentrated into relative density 1.03～1.05 (60 ℃) is subsequent use.Measure and concentrate front and back content of berberine hydrochloride variation, the result is following:

The variation of content before and after table 25 Rhizoma Coptidis aqueous extract concentrates

4.5.3 the concentration technology of Penthorum chinense extracting solution

Need to reclaim ethanol behind the Penthorum chinense aqueous extract precipitate with ethanol; Reconcentration is to the clear paste of certain relative density; We adopt decompression recycling ethanol method (80 ℃ of temperature, vacuum-0.08～-0.1Mpa) reclaim ethanol, and then vacuum-0.08～-clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) under the condition of 0.1Mpa is subsequent use.The result is following:

Ethanol-soluble extractives was measured the result before and after table 26 Penthorum chinense concentrated

Above result shows; Several no changes of ethanol-soluble extractives content before and after concentrating; Therefore 80 ℃ of temperature, vacuum-0.08～-0.1Mpa recover ethanol, and vacuum-0.08～-clear paste that is concentrated into relative density 1.03～1.05 (60 ℃) under the condition of 0.1Mpa is subsequent use.

Below further prove beneficial effect of the present invention through the test of pesticide effectiveness.

Test Example 1 pharmaceutical composition anti-hepatitis virus experiment of the present invention

1, experiment material

1.1 medicine

1.1.1 receive the reagent thing

Pharmaceutical composition extractum of the present invention: the 1g extract powder is equivalent to crude drug in whole 6.8g, is prepared by embodiment 1.Lot number 081101.Clinical consumption 32g crude drug in whole/day, about 60kg calculates by the general body weight of adult, and human dosage is 0.533g crude drug in whole/kg approximately.Adopt during experiment with batch extract powder, get these article and grind afterwards that adding distil water is made into 53.4,106.5,213g (crude drug in whole) dl ^-1That three kinds of concentration liquids supply respectively is little, in, heavy dose of group usefulness, matched group is given distilled water.Experiment mice, rat be little, in, heavy dose is set to 2.67g crude drug in whole/kg, 5.33g crude drug in whole/kg, 10.7g crude drug in whole/kg (being equivalent to intend 5 times, 10 times and 20 times that recommend clinical dosage respectively).

1.1.2 positive drug

Silybin meglumine tablets, Xieli Pharmaceutical Co., Ltd., Hunan produces, lot number 20081201;

Lamivudine, GlaxoSmithKline PLC

XIAOYAN LIDAN PIAN, Tongan City, Shenzhen pharmaceutcal corporation, Ltd produces, lot number 100801;

SHENGMAI ZHUSHEYE, SZYY Group Pharmaceutical Limited. produces, lot number 10072302.

1.2 animal

SD rat, Chengdu reach large bio tech ltd to be provided, and the dispensing feedstuff.The quality certification number: scxk (river) 2008-24.

The KM mice, body weight 20 ± 2g, Chengdu reaches large bio tech ltd to be provided, and the dispensing feedstuff.The quality certification number: scxk (river) 2008-24.

Feeding environment meets SPF level barrier system, credit number 057.20 ± 2 ℃ of receptacle temperature, relative humidity (60 ± 15) %.Laboratory animal divides cage to feed by sex, and every cage is raised with 5 of sex rat/mouse at most.

1.3 reagent and instrument

Acetone: the Long Huagongshijichang of Chengdu section, lot number 20080613;

Sodium sulfide: Chongqing Bei Bei chemical reagent factory, lot number 041023;

Formaldehyde: Chengdu Noah's ark chemical reagent factory, lot number 20080623;

Sodium chloride injection (0.9%), Kelun Pharm Ind Co., Ltd., Sichuan, lot number M090611.

Precision balance: Switzerland's prunus mume (sieb.) sieb.et zucc. Teller-Tuo benefit AB204-E type precise electronic balance

It is thus clear that uv-spectrophotometric appearance: T6 new century, Beijing Puxi General Instrument Co., Ltd

Electronic balance: the ACS-3H-B type, Zhongshan city's sharp electronic scale company limited of gold is produced

2, medicine extracorporeal antivirus effect of the present invention effect

2.1 medicine preparation

Take by weighing pharmaceutical composition extract powder 5 grams of the present invention; Be dissolved in culture fluid with two subunit sulfoxides; Sterile distilled water is diluted to variable concentrations, and each dilution factor contains the crude drug amount and is respectively 5mg/ml, 2.5mg/ml, 1.25mg/ml, 625 μ g/ml, 312 μ g/ml, 156 μ g/ml, 78 μ g/ml, 39 μ g/ml, 20 μ g/ml, 10 μ g/ml.

2.2 toxicity trial

With the digestion of HepG2.2.15 cell routine, processing cell concentration is 1.0 * 10 ⁵The cell suspension of individual/ml is inoculated in 96 orifice plates, and every hole 100ul places 37 ℃, 5%CO ₂, 95% humidity incubator in cultivate 24h; Be grouped into 3 concentration lamivudines (300 μ g/ml, 200 μ g/ml, 100 μ g/ml), 10 concentration pharmaceutical compositions of the present invention (5mg/ml, 2.5mg/ml, 1.25mg/ml, 625 μ g/ml, 312ug/ml, 156ug/ml, 78ug/ml, 39ug/ml, 20ug/ml, 10ug/ml), 0.1% 2 subunit sulfoxide (DMSO), blank control group; Every group 4 multiple holes; Changed liquid once in 48 hours; Carry out cytotoxicity experiment at the 48th hour, 96 hours, 192 hours respectively, read the OD value with ELIASA, wavelength 450/650nm.Be calculated as follows medicine half toxic concentration (TC50).

Half toxic concentration (TC50) computing formula: TC50=Antilog [B+ (50-＜50% suppresses percentage rate)/(＞50% suppresses percentage rate-＜50% suppresses percentage rate) * C]; C=A-B in the formula; A=log (＞50% drug level), B=log (＜50% drug level).

Three concentration lamivudines, 0.1%DMSO be to the equal no cytotoxicity of 2.2.15 cell, but pharmaceutical composition pair cell of the present invention has certain cytotoxicity and along with the enhancing of increasing of concentration, the TC of pharmaceutical composition of the present invention ₅₀Be 2.113mg/ml.

2.3 the antivirus test of pharmaceutical composition of the present invention

With cell suspension inoculation in 24 orifice plates; Be divided into DMSO group, lamivudine group (200ug/ml), 4 pharmaceutical composition concentration group of the present invention (312ug/ml, 156ug/ml, 78ug/ml, 39ug/ml), every group 4 multiple hole, every hole 600ul; Changed liquid once in 48 hours; Difference collecting cell supernatant and cell when changing liquid ,-80 ℃ frozen, to be measured.

2.3.1 supernatant HBsAg, HBeAg detect

Adopt enzyme-linked immunologic detecting kit (Shanghai section China is biological) to detect supernatant HBsAg, HBeAg, the operation of test kit description is pressed in strictness.Medicine is to inhibition percentage rate=(OD of HBsAg/HBeAg _{Control wells}-OD _Experiment _{The hole})/OD _{Control wells}* 100.50% inhibition concentration (TC50) is to be 50% o'clock concentration to HBsAg, HBeAg suppression ratio.

Medicine of the present invention is inhibited to HBeAg, the HBsAg of 2.2.15 emiocytosis; And pharmaceutical composition of the present invention is proportionate to HBeAg, HBsAg suppression ratio and drug level and administration time; When same concentration; Pharmaceutical composition of the present invention is better than HBsAg to the HBeAg inhibitory action, and 312 μ g/ml pharmaceutical composition of the present invention is better than lamivudine group (P＜0.01) to HBeAg, HBsAg inhibitory action when d6.Specifically see Fig. 1,2.

2.3.2 HBVDNA detects in the culture supernatant

Adopt fluorescent quantificationally PCR detecting kit (reaching the peace gene) to detect HBVDNA in the supernatant, the strict test kit description of pressing is operated.Medicine is to suppression ratio=(matched group HBV DNA copy number-experimental group HRVDNA copy number)/matched group HBV DNA copy number x100% of HBV DNA.

Pharmaceutical composition of the present invention can reduce extracellular HBVDNA level to some extent; Its suppression ratio and drug level and administration time are proportionate; The HBVDNA inhibitory action is better than lamivudine (P＜0.01) outside the 312ug/ml pharmaceutical composition pair cell of the present invention when d6, specifically sees Fig. 3.

2.3.3 HBVDNA detects in the cell

Adopt DNA extraction test kit (the sky root is biochemical) to extract total DNA in the cell, employing fluorescent quantificationally PCR detecting kit (reaching the peace gene) detects HBVDNA in the cell, and the strict test kit description of pressing is operated.Medicine is to suppression ratio=(matched group HBV DNA copy number-experimental group HRVDNA copy number)/matched group HBV DNA copy number x100% of HBV DNA.

Estimate clinical drug application prospect, TI=TC with therapeutic index (TI) ₅₀/ IC ₅₀, TI＞2 are effective low toxicity, and 2＞TI＞1 is that poor efficiency is poisonous, and TI＜1 is toxic effect.The 6th day TI is a standard with drug effect.

Pharmaceutical composition of the present invention can reduce HBVDNA level in the cell to some extent, and its suppression ratio and drug level and administration time are proportionate, but pharmaceutical composition of the present invention and lamivudine are relatively, and the two not statistically significant (P＞0.05) is specifically seen Fig. 4.

2.4 pharmaceutical composition extracorporeal antivirus effect mechanism of action of the present invention

With concentration 1.0 * 10 ⁵The cell suspension inoculation of/ml is in 12 orifice plates; Be divided into DMSO group, lamivudine group (200ug/ml), 2 pharmaceutical composition concentration group of the present invention (312ug/ml, 78ug/ml); Every group 4 multiple hole, every hole 1000ul changed liquid once in 48 hours, difference collecting cell supernatant and cell when changing liquid;-80 ℃ frozen, to be measured.

2.4.1 the fluorescence quantitative PCR detection of OAS, PKRmRNA in the cell

According to the Internet Biological Information Resources Aided Design primer sequence be: OASF:CAAGGTGGTAAAGGGTGGCT; OASR:CAAACTTCACGGAAAATGCTCT, 191bp; PKRF:TAACGAGAAGGCGGAGCG; PKRR:CCATTTGGATGAAAAGGCACT, 197bp; The Trizol one-step method is extracted cell total rna; Getting 2 μ g cell total rnas is that template is carried out reverse transcription, and performing PCR when reaction, getting the cDNA that 1 μ l reverse transcription obtains is template; The testing gene primer concentration increases by 30pmol/50 μ l system, and the pcr amplification condition is 94 ℃ of 4min; 94 ℃ of 0.5min; 60 ℃ of 0.5min; 72 ℃ of 0.5min circulate 35 times; 72 ℃ of detection signals.

Pharmaceutical composition of the present invention can increase OAS, PKRmRNA level in the cell, compares with lamivudine group, and high and low concentration pharmaceutical composition group of the present invention difference has statistical significance (P＜0.05), specifically sees Fig. 5.

2.4.2 OAS, PKR albumen WesternBlot detect in the cell

Cell to be measured is with protein cleavage liquid cracking 30min, 4 ℃ of centrifugal 20min of 13000r/min, get contain 50 μ g total proteins supernatant with the 12%SDS-PAGE gel electrophoresis; Spend the night change film after, room temperature sealing 4h on shaking table, film place and contain 1: 500 one anti-or 1: 3000 confidential reference items one anti-confining liquid and hatch 3h; Tris alkali-sodium chloride-polysorbas20 washing liquid (TBST) is washed film 3 times, and 1: 5000 concentration adds that goat-anti rabbit two is anti-to hatch 1.5h, and TBST washes film 3 times; Chemical illuminating reagent is added on the film; Make public in the darkroom immediately, develop a film, film is scanned, use the gray value of UVP gel images processing system Labworks4.6 software analysis purpose band then.

Pharmaceutical composition of the present invention can increase OAS, PKR protein level in the cell, compares with lamivudine group, and high concentration drug group difference of the present invention has statistical significance (P＜0.01), specifically sees Fig. 6,7.

The hepatoprotective effect research of Test Example 2 pharmaceutical compositions of the present invention

Experiment material is with Test Example 1.

1, pharmaceutical composition of the present invention is to the influence of carbon tetrachloride induced mice acute liver damage

60 of kunming mices; Male and female half and half; Be divided into 6 groups at random, 10 every group, be made as blank group, model control group respectively; Receive large, medium and small three dose groups of reagent thing (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to 5,10,20 times of clinical consumption respectively) and silibinin group (0.15g/kg).The administration group is irritated the drug solution that dosage is stated on the Weishang respectively with the 0.1ml/10g body weight, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 7 days.1h each Mus lumbar injection CCL except that the blank group behind the last medicine ₄0.1ml/10g, get blood after 16 hours, separation of serum is measured ALT, AST by the improvement reitman-frankel method.

The result sees table 27, lumbar injection CCL ₄Can cause mice serum ALT and the AST value significantly increases, the large, medium and small dose groups ALT of pharmaceutical composition of the present invention, AST content all have decline in various degree, and significant difference is arranged.Show that pharmaceutical composition of the present invention causes the chmice acute hepatic injury to carbon tetrachloride the better protect effect is arranged.

Table 27 pharmaceutical composition of the present invention is to CCl ₄The influence of induced mice acute liver damage model

Group	Dosage (g/kg)	Number of animals (only)	ALT(karU)	AST(karU)
					Blank	-	10	50.8±18.63**	83.7±19.25**
Pharmaceutical composition of the present invention	2.67	10	140.5±53.9	131.9±27.9*
					Pharmaceutical composition of the present invention	5.33	10	127.5±42.6*	134.8±29.0
Pharmaceutical composition of the present invention	10.67	10	114.5±32.2**	117.7±21.7**
					Silibinin	0.15	10	116.1±41.5*	99.5±17.7**
The model contrast	-	10	176.4±55.6	161.4±34.1

Annotate: compare * P＜0.05 with model, * * P＜0.01

2, pharmaceutical composition of the present invention is to the influence of D-galactosamine induced mice acute liver damage

60 of kunming mices; Male and female half and half; Be divided into 6 groups at random, 10 every group, be made as blank group, model control group respectively; Receive large, medium and small three dose groups of reagent thing (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to 5,10,20 times of clinical consumption respectively) and silibinin group (0.15g/kg).The administration group is irritated the drug solution that dosage is stated on the Weishang respectively with the 0.1ml/10g body weight, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 7 days.1h each Mus lumbar injection 600mg/kg D-galactosamine normal saline solution except that the blank group was got blood after 16 hours behind the last medicine, and separation of serum is measured ALT, AST by the improvement reitman-frankel method.

The result sees table 28; The lumbar injection D-galactosamine can cause mice serum ALT and the AST value significantly increases; The big or middle dose groups ALT of pharmaceutical composition of the present invention, AST are obviously low than model group, show that pharmaceutical composition of the present invention causes the chmice acute hepatic injury to D-galactosamine protective effect is to a certain degree arranged.

Table 28 pharmaceutical composition of the present invention is to the influence

of D-galactosamine induced mice acute liver damage model

Group	Dosage (g/kg)	Number of animals (only)	ALT(karU)	AST(karU)
					Blank	-	10	26.2±7.61**	78.5±12.3**
Pharmaceutical composition of the present invention	2.67	10	113.0±30.8	143.1±38.1
					Pharmaceutical composition of the present invention	5.33	10	106.0±17.2*	145.0±33.9
Pharmaceutical composition of the present invention	10.67	10	100.0±18.5*	135.2±25.9*
					Silibinin	0.15	10	94.5±31.9*	113.5±32.6**
The model contrast	-	10	141.5±49.4	170.4±31.6

Annotate: compare * P＜0.05 with model, * * P＜0.01

3, pharmaceutical composition of the present invention is to the influence of rat chronic hepatic injury due to the carbon tetrachloride

60 of SD rats; Male and female half and half; Be divided into 6 groups at random, 10 every group, be made as blank group, model control group respectively; Receive large, medium and small three dose groups of reagent thing (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to 5,10,20 times of clinical consumption respectively) and silibinin group (0.15g/kg).The administration group is irritated the drug solution that dosage is stated on the Weishang respectively with the 1ml/100g body weight, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 90 days.Administration is each Corium Mus injected carbon tetrachloride 2 times weekly except that the blank group simultaneously, continuous 3 months.Get blood after the off-test, separation of serum is measured ALT, AST by the improvement reitman-frankel method.

Table 29 pharmaceutical composition of the present invention is to the influence of rat chronic liver injury model due to the CCl4

Group	Dosage (g/kg)	Number of animals (only)	ALT(karU)	AST(karU)
					Blank	-	10	26.5±8.18**	73.6±18.2**
Pharmaceutical composition of the present invention	2.67	10	77.5±20.2	111.8±21.2
					Pharmaceutical composition of the present invention	5.33	10	75.1±17.5	109.0±21.4
Pharmaceutical composition of the present invention	10.67	10	68.2±18.5*	103.0±16.8*
					Silibinin	0.15	10	64.7±18.8*	94.7±12.3**
The model contrast	-	10	83.8±14.5	125.9±27.8

Annotate: compare * P＜0.05 with model, * * P＜0.01

By table 29 knowledge; Subcutaneous injection of carbon tetrachloride 2 times weekly; Can cause rat blood serum ALT in continuous 3 months and the AST value significantly increases, pharmaceutical composition of the present invention has the certain protection effect to the rat chronic hepatic injury due to the carbon tetrachloride, and ALT, AST are obviously reduced than animal pattern.Pseudolobuli extensively forms in the pathologic finding display model group liver, and drug group has some improvement.

The Study immune regulation of Test Example 3 pharmaceutical compositions of the present invention

Experiment material is with Test Example 1.

1, pharmaceutical composition of the present invention is engulfed the influence of chicken red blood cell ability to Turnover of Mouse Peritoneal Macrophages

50 of kunming mices, male and female half and half are divided into 5 groups at random; Every group 10; Be made as the blank group respectively, receive large, medium and small three dose groups of reagent thing (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to 5,10,20 times of clinical consumption respectively) and SHENGMAI ZHUSHEYE group (20ml/kg).The administration group is irritated the drug solution that dosage is stated on the Weishang respectively with the 0.1ml/10g body weight, and the blank group is given isopyknic normal saline.Every day 1 time, successive administration 7 days.Each Mus lumbar injection 5% chicken red blood cell 0.4ml of 1h behind the last medicine put to death after 8 hours, and intraperitoneal injection of saline 2ml gently rubs the peritoneal fluid of back extraction for several times 1ml; Drip and to be applied on the clean slide, be put in the enamel tray that is lined with wet gauze, placed 37 ℃ of incubators 30 minutes, take out slide; With the normal saline rinsing, dry, fix 5 minutes with acetone-methanol solution (1: 1); Dyeed 5 minutes with 4% Ji Mu Sa-Rui Teshi liquid, the distilled water rinsing is dried again.Under oily mirror, count several 200 of macrophage for every, be calculated as follows its phagocytic index and phagocytic percentage.

Phagocytic percentage=(engulfing macrophage/200 macrophage of chicken red blood cell) * 100%

Chicken red blood cell sum/200 macrophages that phagocytic index=quilt is engulfed

Table 30 pharmaceutical composition of the present invention is engulfed the influence

of chicken red blood cell ability to Turnover of Mouse Peritoneal Macrophages

Annotate: compare * P＜0.05, * * P＜0.01, * * * P＜0.001 with blank

The result sees table 30; The result shows in the pharmaceutical composition of the present invention, heavy dose of group is significantly increased than matched group to Turnover of Mouse Peritoneal Macrophages phagocytic rate, phagocytic index; Explain that pharmaceutical composition of the present invention can strengthen the phagocytosis of Turnover of Mouse Peritoneal Macrophages to chicken red blood cell, shows the function that certain enhance immunity is arranged.

2, pharmaceutical composition of the present invention causes the mice hemolytic antibody to cyclophosphamide and generates low influence

60 of kunming mices; Male and female half and half; Be divided into 6 groups at random, 10 every group, be made as blank group, model control group respectively; Receive large, medium and small three dose groups of reagent thing (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to 5,10,20 times of clinical consumption respectively) and SHENGMAI ZHUSHEYE group (20ml/kg).The administration group is irritated the drug solution that dosage is stated on the Weishang respectively with the 0.1ml/10g body weight, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 7 days.In addition, all the other respectively organize subcutaneous injection cyclophosphamide 20mg/kg except that the normal control group, and 1 time/2 days, totally 3 times; Every Mus is with the immunity of 5% Sanguis Gallus domesticus ball 0.2ml lumbar injection behind the first administration 1h, and each Mus was got blood 20ul in eye socket on 1, adds the 1ml normal saline; Add 4% chicken erythrocyte 0.5ml, 10% GPS 0.5ml again, in 37 ℃ of water-baths, hatch 40min, the ice bath cessation reaction; In the centrifugal 10min of 2000rpm, get supernatant 1ml, add 3ml Dou Shi liquid; Mixing returns to zero with Dou Shi liquid in 540nm behind the 10min, measures and respectively manages trap.

Visible by table 31, the normal control group has notable difference (P＜0.001) with the model group ratio, and model group moulding success is described; Big or middle dose groups of pharmaceutical composition of the present invention and model group compare, and its trap significantly increases, and shows that pharmaceutical composition of the present invention causes the mice hemolytic antibody to cyclophosphamide tangible antagonism is lowly arranged.

Table 31 pharmaceutical composition of the present invention generates low influence

to caused by cyclophosphamide mice hemolysin

Annotate: compare * P＜0.05 with model, * * P＜0.01, * * * P＜0.001

The choleretic effect research of Test Example 4 pharmaceutical compositions of the present invention

Experiment material is with Test Example 1.

50 of SD rats, male and female half and half are divided into 5 groups at random; Every group 10; Be made as the blank group respectively, receive large, medium and small three dose groups of reagent thing (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to 5,10,20 times of clinical consumption respectively) and XIAOYAN LIDAN PIAN group (6/kg).Fasting can't help water 12 hours, and behind 10% chloral hydrate (3ml/kg) intraperitoneal injection of anesthesia, it is fixing to face upward the position, along abdomen median line otch 2cm, finds stomachus pyloricus, and the upset duodenum finds the bile duct of white flexible in the descendant duodenum mesentery.Under bile duct, wear 2 rhizoid lines, the ligation pars papillaris is made one " V " shape otch to the liver direction, inserts plastic tube (it is thus clear that having faint yellow bile to flow out), and ligation is fixed, and collects bile.Postoperative closes stomach wall with the hemostasis clamp, and saline gauze covers; Postoperative was stablized 20 minutes, collect earlier 30 minutes bile as administration before data, respectively organize rat then by duodenum administration respectively, the administration group is irritated the drug solution with above-mentioned dosage respectively with the 1ml/100g body weight, the blank group is given isopyknic normal saline.Collected bile 1 time in per 30 minutes after the administration, totally 3 times, the record choleresis.

The result sees table 32, and the result shows that pharmaceutical composition of the present invention has certain promotion bile secretion effect.

Table 32 pharmaceutical composition of the present invention is to the influence

of rat bile secretory volume

Annotate: compare * P＜0.05 with model, * * P＜0.01

The clinical trial of Test Example 5 medicine therapeutic virus property hepatitis ies of the present invention

A: function: eliminating damp-heat, detoxifcation pain relieving, dissipating blood stasis protect the liver.Cure mainly Type B viral hepatitis, traditional Chinese medical science dampness-heat in the liver and gallbladder folder stasis of blood type, disease is seen distending pain over the hypochondrium and twinge, irritated irritability, visible jaundice or do not have jaundice, bitter taste is indigestion and loss of appetite, vomiting and nausea abdominal distention, fatigue and weakness, yellow fur or yellow greasy, wiry and frequent pulse etc.

B: diagnostic criteria:

(1) Western medicine diagnose standard

1. clinically mainly show as weak, loss of appetite, feel sick, vomiting, hepatomegaly and liver function injury, part patient can have jaundice and heating, inapparent infection is also more common.

2. etiological diagnosis has following any 1 positive, and diagnosable is that existing disease HBV infects: serum HbsAg is positive; Serum HBV DNA is positive; Serum anti HBc IgM titre is high, and anti-HbcIgG is negative or low-level.

(2) the dialectical standard of traditional Chinese medical science dampness-heat in the liver and gallbladder folder stasis of blood type

3. primary symptom: yellow skin and eye, yellow distinct, the pain over the hypochondriac region, the vexed abdominal distention of gastral cavity, dysphoria with smothery sensation, xerostomia and hardship, yellowish or reddish urine, red tongue, yellow and greasy fur.

4. inferior disease: inappetence, nausea and vomiting, sleepy weak, skin pruritus, constipation or thin, stringy and rolling pulse number.

C: curative effect of disease criterion (reference in JIUYUE, 2000 China medical association's infectious disease is worked out with " viral hepatitis is prevented and treated scheme " that revision is united in parasitic disease credit meeting, the Xi'an meeting of hepatopathy association)

(1) produce effects: transference cure, liver spleen recover normal or retraction, no tenderness and kowtow pain, and liver function recovery is normal, all cloudy commentaries on classics of HBV DNA, HbeAg, HbsAg.Above each item index was stablized more than 6 months.

(2) effective: symptom obviously alleviates or disappears, and hepatosplenomegaly is stable and constant, does not have obvious tenderness and kowtows pain, and liver function test recovers normal or descends more than 50% than exceptional value before the treatment, and HBV DNA, HbeAg, HbsAg have 1 cloudy commentaries on classics.

D a: daily dose: group 1: Rhizoma Polygoni Cuspidati 15g, Radix Sophorae Tonkinensis 6g, Penthorum chinense 24g, Rhizoma Coptidis 5g; Group 2: Rhizoma Polygoni Cuspidati 12g, Radix Sophorae Tonkinensis 6g, Penthorum chinense 12g, Rhizoma Coptidis 2g; Group 3: Rhizoma Polygoni Cuspidati 12g, Radix Sophorae Tonkinensis 3g, Penthorum chinense 9g, Rhizoma Coptidis 5g; Group 4: Rhizoma Polygoni Cuspidati 9g, Radix Sophorae Tonkinensis 4.5g, Penthorum chinense 18g, Rhizoma Coptidis 3.5g; Method by embodiment 1 is prepared into capsule, and is oral, one time 3,3 times on the one, 3 months courses of treatment.

Result of the test:

Group 1:60 example produce effects 28 examples account for 77.8%, and effective 4 examples account for 4.8%

Group 2:72 example produce effects 62 examples account for 86.1%, and effective 8 examples account for 11.1%

Group 3:58 example produce effects 21 examples account for 63.8%, and effective 3 examples account for 5.2%

Group 4:66 example produce effects 43 examples account for 65.2%, and effective 3 examples account for 4.5%

Can know that by The above results each proportioning group all has the effect of treatment hepatitis B, wherein best to organize 2 drug effect.

Above-mentioned effect experiment and clinical test results explanation: the test of (one) extracorporeal antivirus effect shows that pharmaceutical composition of the present invention can reduce HBVDNA in extracellular HBsAg, HBeAg, HBV DNA and the cell in various degree; This effect has time and drug level dependency; And pharmaceutical composition of the present invention can increase the mRNA level of OAS, PKR in the cell, strengthens OAS, PKR protein level.Show that pharmaceutical composition of the present invention inside and outside all has anti-certain anti-HBV effect.(2) pharmaceutical composition of the present invention can obviously suppress Serum ALT and AST value that carbon tetrachloride causes the chmice acute hepatic injury and increases; Serum ALT and AST value that D-galactosamine is caused the chmice acute hepatic injury increase also has remarkable inhibition; Can make that the Serum ALT and the AST value of rat chronic hepatic injury increases obvious reduction due to the carbon tetrachloride, pathological section shows can improve hepatic injury.Show that pharmaceutical composition of the present invention has significant hepatoprotective effect.(3) pharmaceutical composition of the present invention is engulfed the chicken red blood cell ability to Turnover of Mouse Peritoneal Macrophages and is significantly increased, and Turnover of Mouse Peritoneal Macrophages phagocytic rate, phagocytic index are significantly increased than matched group; Cyclophosphamide is caused the mice hemolytic antibody generate the effect that lowly is significantly improved.Showing that pharmaceutical composition of the present invention has improves immunity function preferably.(4) pharmaceutical composition of the present invention improves to the rat bile secretory volume, shows that pharmaceutical composition of the present invention has certain choleretic effect.

Claims

1. pharmaceutical composition of preventing and treating hepatitis B, it is characterized in that: it is the preparation that is prepared from following materials of weight proportions medicine:

2. pharmaceutical composition according to claim 1 is characterized in that: it is the preparation that is prepared from following materials of weight proportions medicine:

3. pharmaceutical composition according to claim 2 is characterized in that: it is the preparation that is prepared from following materials of weight proportions medicine:

4. according to any described pharmaceutical composition of claim 1-3; It is characterized in that: it is to be active component by raw material medicated powder of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis, Penthorum chinense, Rhizoma Coptidis or extractive with organic solvent, adds acceptable accessories or complementary composition and is prepared into preparation pharmaceutically commonly used.

5. pharmaceutical composition according to claim 4 is characterized in that: described preparation is decoction, powder, pill, granule, tablet, capsule, oral liquid or drop pill.

6. pharmaceutical composition according to claim 5 is characterized in that: in the described capsule, every contains Rhizoma Polygoni Cuspidati with emodin C ₁₅H ₁₀O ₅Meter must not be less than 4.50mg.

7. method for preparing any described pharmaceutical composition of claim 1-6, it comprises the steps:

8. preparation of drug combination method according to claim 7 is characterized in that: described preparation is a capsule, and its preparation method is:

D, above-mentioned each concentrated solution of merging adopt conventional method of granulating to granulate, and be encapsulated, promptly gets.

9. preparation of drug combination method according to claim 8 is characterized in that: the method for preparing of described capsule is:

D, above-mentioned each clear paste of merging are spray drying under 90～100 ℃ of conditions in 180～200 ℃ of EATs, leaving air temp, collect spray powder; Be lower than 60.5% in relative humidity, dry granulation under the condition that temperature is 18～22 ℃, principal pressure 4.5～5.5Mpa; Lateral pressure 0.25Mpa sieves, and collects the granule of 40～60 mesh sieves; Encapsulated, promptly get.

Any described pharmaceutical composition of claim 1-8 protect the liver in preparation, the purposes in the medicine of enhance immunity or function of gallbladder promoting, prevention or treatment hepatitis B.